Topics

<Return to clone list

ID  21-W364
Registered  2010.05.02    Last Update  2015.02.09
Gene Name methyl-CpG binding domain protein 5 Gene Symbol Mbd5
Chromosome 2 Genomic Location chr2:48,804,500-48,880,000
Synonyms Gm1630, AA536666, AI426407, 9430004D19Rik, C030040A15Rik, OTTMUSG00000012483
Links UCSC Browser(chr2:48,804,500-48,880,000)
NCBI Entrez Gene(109241)
IGTC(Mbd5, 23466)
UniGene(Mm.440436)
MGI(2138934)
KEGG GENES(mmu:109241)
EST Profile(Mm.440436)
Other clone traped this gene
21-B205
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB558980 GSS Location chr2:48,805,426-48,805,695 Size 270
Sequence TGGCCGGGAGAGAAGGAGAGAAAGAGACCAAAAGCCTCTTAGCAACACAGACCCTTGGCTGCTGC
TGCTGCTACTGCTGCTGCTGCTGCTGCTGTTGCTGTTGCTGCTGCTTGGCCCTGGCTGAAGACAT
CTCCCTACACCGGGAGCAGCCACTTCCCCAGCTCTCCTCCTCCTCCTTCGCCTCCTCCTCCTCCA
CTCCCCCCCTTTATTACCCTTTGTGTCATCCTCCACAGCTCCAGGGAAGGCACTCAAAAGTGGGG
GGCAGGAAAG
Links UCSC Browser(chr2:48,805,426-48,805,695)
IGTC(Ayu21-W364)

Homology Search Results

[AK083019] Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length enriched library, clone:C530034A12 product:unclassifiable, full insert sequence.

Mouse Information

Card ID 2207 Strain Name B6,Cg-Mbd5Gt(pU-21W)364Card
Internal Code Ayu21-W364
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Mbd5)

<Return to clone list