Topics

<Return to clone list

ID  21-W368
Registered  2009.10.17    Last Update  2018.10.26
Gene Name L1 repetitive element Gene Symbol L1
Chromosome Unlocalized Genomic Location
Synonyms
Links UCSC Browser
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
21-100, 21-B108, 21-T40, 21-B192, 21-W562, 21-T158, 21-B140, 21-T202, 21-T203, 21-T217, 21-T298, 21-T220, 21-T257, 21-T292, 21-T260, 21-T305, 21-T316, 21-T76, 21-T99, 21-T311, 21-T457, 21-T423, 21-T481, 21-W78, 21-W93, 21-W75, 21-W82, 21-W141, 21-KBW135, 21-W190, 21-W259, 21-W235, 21-W287, 21-KBW168, 21-T45, 21-W396, 21-W425, 21-W365, 21-W450, 21-W467, 21-W537, 21-W519, 21-W539, 21-KBW260, 21-KBW270, 21-MT95, 21-T999, 21-B179
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB525782 GSS Location Size 259
Sequence CCATCTTGGTCCGAGACCCGCCGAACTTAGGAAATTAGTNTGAACAGGTGAGAGGGTGCGCCAGA
GAACCTGACAGCTTCTGGAACAGGCGGAAGCACAGAGGGGCTGAGGCAGCACCCTGTGTGGGCCG
GGGACAGCCGGCCACCTTCCGGACCAGAGGACAGGTGCCCACCCGGCTGGGGAGGCGGCTTAAGC
CACAGCAGCAGCGGTCGCCATCTTGGTCCGGGACCCGCCGAACTTAGGAAATTAGTCTGAACAG
Links UCSC Browser
IGTC

Homology Search Results

[D84391] Mouse L1 repetitive element, complete sequence.

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for L1)

<Return to clone list