Topics

<Return to clone list

ID  21-W371
Registered  2009.12.02    Last Update  2015.04.11
Gene Name angiogenin, ribonuclease, RNase A family, 5 Gene Symbol Ang
Chromosome 14 Genomic Location chr14:51,710,500-51,726,000
Synonyms Rnase4, Ang1, Rnase5, Rnase5a, AI385586
Links UCSC Browser(chr14:51,710,500-51,726,000)
NCBI Entrez Gene(11727)
IGTC(Ang, 46773)
UniGene(Mm.202665)
MGI(88022)
KEGG GENES(mmu:11727)
EST Profile(Mm.202665)
Other clone trapped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB535726 GSS Location chr14:51,710,821-51,710,928 Size 108
Sequence ACCCATATCGGGGACGAGATTCCAAAGGAAATTTCATTCTTCTATTCGCCATCCCAACAGGAAGG
AAGGAGTGAGAAACAAAGCTGCCGCCTCCAGTTCCGGGTCCAG
Links UCSC Browser(chr14:51,710,821-51,710,928)
IGTC(Ayu21-W371)

Homology Search Results

[NM_001161731] Mus musculus angiogenin, ribonuclease, RNase A family, 5 (Ang), transcript variant 2, mRNA.
[NM_021472] Mus musculus ribonuclease, RNase A family 4 (Rnase4), transcript variant 1, mRNA.

Mouse Information

Card ID 1693 Strain Name B6;CB-AngGt(pU-21W)371Card
Internal Code Ayu21-W371
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Trap vector was inserted in the intron behind the common first exon of Ang and Rnase4. Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "Conformational Change in Transfer RNA Is an Early Indicator of Acute Cellular Damage." Mishima, E., Inoue, C., Saigusa, D., Inoue, R., Ito, K., Suzuki, Y., Jinno, D., Tsukui, Y., Akamatsu, Y., Araki, M., Araki, K., Shimizu, R., Shinke, H., Suzuki, T., Takeuchi, Y., Shima, H., Akiyama, Y., Toyohara, T., Suzuki, C., Saiki, Y., Tominaga, T., Miyagi, S., Kawagisihi, N., Soga, T., Ohkubo, T., Yamamura, K., Imai, Y., Masuda, S., Sabbisetti, V., Ichimura, T., Mount, D. B., Bonventre, J. V., Ito, S., Tomioka, Y., Itoh, K., Abe, T., J. Am. Soc. Nephrology, 25 (10), 2316-2326 (2014). PubMed ID:24833129.
Links IMSR (for Ang)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list