Topics

<Return to clone list

ID  21-W375
Registered  2009.10.17    Last Update  2011.10.17
Gene Name neural precursor cell expressed, developmentally down-regulated gene 4-like Gene Symbol Nedd4l
Chromosome 18 Genomic Location chr18:65,046,000-65,380,000
Synonyms Nedd4b, Nedd4-2, 1300012C07Rik
Links UCSC Browser(chr18:65,046,000-65,380,000)
NCBI Entrez Gene(83814)
IGTC(Nedd4l, 1395)
UniGene(Mm.98668)
MGI(1933754)
KEGG GENES(mmu:83814)
EST Profile(Mm.98668)
Other clone trapped this gene
21-W577, 21-W301, 21-W439, 21-W553
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB525786 GSS Location chr18:65,047,444-65,047,749 Size 305
Sequence CCATCGGCGGGGCGGGAGCCCGGCGGGCTCAGCGCAGAGCAGGGAGAGCTCCGGGCCAGTCGCCG
TTCGGCGCGCTCTCGGGAGCCGCCAGTCCGCGCGTCCCCGCAGCTTTCCGGGAGGAAGCGGCGCC
GCGGCCGGGTGCAGCCTCACCTGCCGGCCCTTCCCCGCCGGGCGGCGCAGAAGGACAGAGGGTCG
CGGCTCCGCGACGCACTTCAGCCAGTCGCAGCGTCCAGGACCCTGCGCGGGGCGCCGGCTCCATG
GCGACCGGGCTTGGGGAGCCTGTCTACGGACTTTCGGAAGAGGAG
Links UCSC Browser(chr18:65,047,444-65,047,749)
IGTC(Ayu21-W375)

Homology Search Results

[NM_031881] Mus musculus neural precursor cell expressed, developmentally down-regulated gene 4-like (Nedd4l), transcript variant 2, mRNA.

Mouse Information

Card ID 1694 Strain Name B6;CB-Nedd4lGt(pU-21W)375Card
Internal Code Ayu21-W375
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Nedd4l)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list