| Topics |
ID 21-W375
| Gene Name | neural precursor cell expressed, developmentally down-regulated gene 4-like | Gene Symbol | Nedd4l | ||||
|---|---|---|---|---|---|---|---|
| Chromosome | 18 | Genomic Location | chr18:65,046,000-65,380,000 | ||||
| Synonyms | Nedd4b, Nedd4-2, 1300012C07Rik | ||||||
| Links | UCSC Browser(chr18:65,046,000-65,380,000) NCBI Entrez Gene(83814) IGTC(Nedd4l, 1395) UniGene(Mm.98668) |
MGI(1933754) KEGG GENES(mmu:83814) EST Profile(Mm.98668) |
|||||
| Other clone trapped this gene |
|---|
| 21-W577, 21-W301, 21-W439, 21-W553 |
| Trap vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
|---|---|---|---|---|---|
| Accession | AB525786 | GSS Location | chr18:65,047,444-65,047,749 | Size | 305 |
| Sequence | CCATCGGCGGGGCGGGAGCCCGGCGGGCTCAGCGCAGAGCAGGGAGAGCTCCGGGCCAGTCGCCG TTCGGCGCGCTCTCGGGAGCCGCCAGTCCGCGCGTCCCCGCAGCTTTCCGGGAGGAAGCGGCGCC GCGGCCGGGTGCAGCCTCACCTGCCGGCCCTTCCCCGCCGGGCGGCGCAGAAGGACAGAGGGTCG CGGCTCCGCGACGCACTTCAGCCAGTCGCAGCGTCCAGGACCCTGCGCGGGGCGCCGGCTCCATG GCGACCGGGCTTGGGGAGCCTGTCTACGGACTTTCGGAAGAGGAG |
||||
| Links | UCSC Browser(chr18:65,047,444-65,047,749) IGTC(Ayu21-W375) |
||||
Homology Search Results
| [NM_031881] Mus musculus neural precursor cell expressed, developmentally down-regulated gene 4-like (Nedd4l), transcript variant 2, mRNA. |
Mouse Information
| Card ID | 1694 | Strain Name | B6;CB-Nedd4lGt(pU-21W)375Card |
|---|---|---|---|
| Internal Code | Ayu21-W375 | ||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||
| Links |
IMSR (for Nedd4l) |
||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |