Topics

<Return to clone list

ID  21-W377
Registered  2009.09.10    Last Update  2011.04.22
Gene Name zinc finger protein 13 Gene Symbol Zfp13
Chromosome 17 Genomic Location chr17:23,712,000-23,737,000
Synonyms Zfp-13, Krox-8, AI835008, 4933429B21
Links UCSC Browser(chr17:23,712,000-23,737,000)
NCBI Entrez Gene(22654)
IGTC(Zfp13, 6936)
UniGene(Mm.40326)
MGI(99159)
KEGG GENES(mmu:22654)
EST Profile(Mm.40326)
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB520832 GSS Location chr17:23,736,009-23,736,067 Size 59
Sequence GGAGGCGCGGCGAGCAGGGTGAAGGAGTGGAGAGCTTTCTCTAACAGCAGCTGGGCACA
Links UCSC Browser(chr17:23,736,009-23,736,067)
IGTC(Ayu21-W377)

Homology Search Results

Mouse Information

Card ID 1695 Strain Name B6;CB-Zfp13Gt(pU-21W)377Card
Internal Code Ayu21-W377
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Zfp13)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list