Topics

<Return to clone list

ID  21-W390
Registered  2009.11.17    Last Update  2018.10.27
Gene Name EST Gene Symbol EST
Chromosome 2 Genomic Location chr2:165,609,000-165,729,000
Synonyms
Links UCSC Browser(chr2:165,609,000-165,729,000)
NCBI Entrez Gene
IGTC
UniGene(Mm.227598)
MGI
KEGG GENES
EST Profile(Mm.227598)
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB533331 GSS Location chr2:165,635,788-165,641,032 Size 301
Sequence TCACTTCAGGATGGACCAGAGGGAGCATGGCTGTAGAGAAGCTAGGAGCATNGCCTAGCCACCTC
GGAGAAAGACCATCCACCCACCACCAAGGAGCTTCACAGGGACACCGGTTTACAGAAGTTGAGCT
GGAACCGGCTTCGAATCTGCCGCTTGGGAGAGATGAGAGGGACGGGGGCTGACTGCTGCTGGACC
GACTCGCTCAGCTCCTTCAGGTCCATCTCGGCCTTGCTTCGATCTGGAAGACACCAGTATAGCCT
CAATCAGACCAGGTTCTCACACTCCACCACCCACCACTCAG
Links UCSC Browser(chr2:165,635,788-165,641,032)
IGTC

Homology Search Results

[CL866139] AT0678 Sanger Institute Gene Trap Library pGT0lxr Mus musculus cDNA, mRNA sequence.

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. In this clone, the anti-sense RNA of Zmynd8 gene might be trapped.
Links IMSR (for EST)

<Return to clone list