Topics

<Return to clone list

ID  21-W403
Registered  2010.11.05    Last Update  2020.06.02
Gene Name zinc finger protein 979 Gene Symbol Zfp979
Chromosome 4 Genomic Location chr4:146,985,000-147,018,000
Synonyms 2610305D13Rik, Ssm1b
Links UCSC Browser(chr4:146,985,000-147,018,000)
NCBI Entrez Gene(112422)
IGTC(Zfp979, 10270)
UniGene(Mm.422608)
MGI(2148252)
KEGG GENES(mmu:112422)
EST Profile(Mm.422608)
Other clone traped this gene
21-W208, 21-MT44, 21-MT5
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB598113 GSS Location chr4:147,015,021-147,016,645 Size 267
Sequence TGACTGGAAGTTCCGCCATCCCATCATTCTCGATGTATCTCGGCTGCCTCGTGGTCAGGAAGCCA
TGGAAGGAGACTAGTGCCTAGTATTTGCGGAACCTGAAAACTTCCTTAAGCTGCAGTTGCTGTGC
TGGCCTCCTAGGACATTCAGCAGCTGGTCCTGTTGCCTTCCAGGTCTCCATATGCTCAGTCAACT
CTCCATAACTGTAAATCAACACTAAGAGCACTAGAAGGTTAAAGGTCAAGGAGACTCTCACAAAG
GATCCAG
Links UCSC Browser(chr4:147,015,021-147,016,645)
IGTC(Ayu21-W403)

Homology Search Results

[NM_145078] Mus musculus RIKEN cDNA 2610305D13 gene (2610305D13Rik), mRNA.

Mouse Information

Card ID 2884 Strain Name B6;CB-Zfp979Gt(pU-21W)403Card
Internal Code Ayu21-W403
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Zfp979)

<Return to clone list