Topics

<Return to clone list

ID  21-W412
Registered  2010.11.23    Last Update  2012.01.16
Gene Name RAB geranylgeranyl transferase, b subunit Gene Symbol Rabggtb
Chromosome 3 Genomic Location chr3:153,570,000-153,576,000
Synonyms
Links UCSC Browser(chr3:153,570,000-153,576,000)
NCBI Entrez Gene(19352)
IGTC(Rabggtb, 2984)
UniGene(Mm.277831)
MGI(99537)
KEGG GENES(mmu:19352)
EST Profile(Mm.277831)
Other clone trapped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB601827 GSS Location chr3:153,574,889-153,574,997 Size 123
Sequence CGGCGGTCGGACATGGGCACACAGCAGAAAGACGTTACTATCAAGTCAGATGCGCCTGACACCCT
GTTGCTGGAGAAGCATGCCGATTATATTGCTTCCTATGGCTCAAAGAAAGATGATTAT
Links UCSC Browser(chr3:153,574,889-153,574,997)
IGTC(Ayu21-W412)

Homology Search Results

[NM_011231] Mus musculus RAB geranylgeranyl transferase, b subunit (Rabggtb), transcript variant 1, mRNA.

Mouse Information

Card ID 1832 Strain Name B6;CB-RabggtbGt(pU-21W)412Card
Internal Code Ayu21-W412
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Rabggtb)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list