Topics |
Gene Name | RAB geranylgeranyl transferase, b subunit | Gene Symbol | Rabggtb | ||||
---|---|---|---|---|---|---|---|
Chromosome | 3 | Genomic Location | chr3:153,570,000-153,576,000 | ||||
Synonyms | |||||||
Links | UCSC Browser(chr3:153,570,000-153,576,000) NCBI Entrez Gene(19352) IGTC(Rabggtb, 2984) UniGene(Mm.277831) |
MGI(99537) KEGG GENES(mmu:19352) EST Profile(Mm.277831) |
Other clone trapped this gene |
---|
Trap vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
---|---|---|---|---|---|
Accession | AB601827 | GSS Location | chr3:153,574,889-153,574,997 | Size | 123 |
Sequence | CGGCGGTCGGACATGGGCACACAGCAGAAAGACGTTACTATCAAGTCAGATGCGCCTGACACCCT GTTGCTGGAGAAGCATGCCGATTATATTGCTTCCTATGGCTCAAAGAAAGATGATTAT |
||||
Links | UCSC Browser(chr3:153,574,889-153,574,997) IGTC(Ayu21-W412) |
[NM_011231] Mus musculus RAB geranylgeranyl transferase, b subunit (Rabggtb), transcript variant 1, mRNA. |
Card ID | 1832 | Strain Name | B6;CB-RabggtbGt(pU-21W)412Card |
---|---|---|---|
Internal Code | Ayu21-W412 | ||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||
Links |
IMSR (for Rabggtb) |
Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
---|---|
Image | Male Female |