Topics

<Return to clone list

ID  21-W426
Registered  2009.11.20    Last Update  2018.10.27
Gene Name WW domain binding protein 1 like Gene Symbol Wbp1l
Chromosome 19 Genomic Location chr19:46,671,768-46,735,146
Synonyms D19Wsu162e, MGC31104
Links UCSC Browser(chr19:46,671,768-46,735,146)
NCBI Entrez Gene(226178)
IGTC(Wbp1l, 12655)
UniGene(Mm.329895)
MGI(107577)
KEGG GENES(mmu:226178)
EST Profile(Mm.329895)
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB533339 GSS Location chr19:46,673,664-46,681,249 Size 168
Sequence CCGTGGCGGAGGAGCAGGAGCAGGAGGGGGATGGAGAGGAGAAGGCTCCTGGGTGGCATGGCGCT
CCTGCTCCTCCAGGCGCTGCCCAGCCCCCTGTCAGTGAGGGCTGAGCCCCCGCAGGTGCGCTTGA
GAAGTCAGAAGACAGTGGGACTGGTTCGGGCCTACCAG
Links UCSC Browser(chr19:46,673,664-46,681,249)
IGTC(Ayu21-W426)

Homology Search Results

[NM_146099] Mus musculus DNA segment, Chr 19, Wayne State University 162, expressed (D19Wsu162e), mRNA.

Mouse Information

Card ID 1740 Strain Name B6;CB-D19Wsu162eGt(pU-21W)426Card
Internal Code Ayu21-W426
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "Development of an efficient screening system to identify novel bone metabolism-related genes using the exchangeable gene trap mutagenesis mouse models."Syuji Kurogi, Tomohisa Sekimoto, Taro Funamoto, Tomomi Ota, Shihoko Nakamura, Takuya Nagai, Mai Nakahara, Kumiko Yoshinobu, Kimi Araki, Masatake Araki and Etsuo Chosa, Sci. Rep., 7, 40692 (2017). doi: 10.1038/srep40692. PubMed ID:28106071.
Links IMSR (for Wbp1l)

<Return to clone list