Topics

<Return to clone list

ID  21-W431
Registered  2010.05.02    Last Update  2018.10.27
Gene Name microtubule-associated protein 7 Gene Symbol Map7
Chromosome 10 Genomic Location chr10:19,868,000-20,002,000
Synonyms Mtap7, ste, MAP7, mshi, mste, R75000, E-MAP-115
Links UCSC Browser(chr10:19,868,000-20,002,000)
NCBI Entrez Gene(17761)
IGTC(Map7, 8846)
UniGene(Mm.20928)
MGI(1328328)
KEGG GENES(mmu:17761)
EST Profile(Mm.20928)
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB558982 GSS Location chr10:19,868,795-19,868,886 Size 92
Sequence TCTCCCGGCGCGTCATCGGAGCACCATGGCGGAGCAGGGAGCTGGCGGCGACGGCCACAGGGGCG
GCGACGGCGCTACGCACAGCGACCCAG
Links UCSC Browser(chr10:19,868,795-19,868,886)
IGTC(Ayu21-W431)

Homology Search Results

[NM_008635] Mus musculus microtubule-associated protein 7 (Mtap7), mRNA.

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for Map7)

<Return to clone list