Topics

<Return to clone list

ID  21-W445
Registered  2010.05.02    Last Update  2018.10.27
Gene Name New Gene Symbol New
Chromosome 11 Genomic Location chr11:5,580,000-5,610,000
Synonyms
Links UCSC Browser(chr11:5,580,000-5,610,000)
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB558986 GSS Location chr11:5,592,948-5,599,918 Size 284
Sequence GGGGGGGGGGGGCTTCCCCCTTTATAAGCACAGTTTCTGAGTAAAATTTCAGGCCTTGATCAGCA
CCTTTACGGGCCGGCATACATCAGATTGGTGCCCTGAACAGCAACAAACGGGAAACATTGGGAAT
GGTGGGAAAACACTGCGGGAACGCTGCTTGGTGTGGAGCTCCATGGGAAGGAAAGAATCAGAGGA
CCGGATCGTATCGGGCACGGTGAGCAACAGATCAAGGCAGAGCGTTCCTCCACTAACTTGGATGA
ATTATGGAAGTACTGGCAGGACTG
Links UCSC Browser(chr11:5,592,948-5,599,918)
IGTC

Homology Search Results

Mouse Information

Card ID 1856 Strain Name B6;CB-Gt(pU-21W)445Card
Internal Code Ayu21-W445
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for New)

<Return to clone list