Topics

<Return to clone list

ID  21-W453
Registered  2010.05.20    Last Update  2018.10.27
Gene Name teneurin transmembrane protein 4 Gene Symbol Tenm4
Chromosome 7 Genomic Location chr7:103,350,000-104,070,000
Synonyms Odz4, l7Rn3, ELM2, Ten-m4, l(7)-3Rn, Doc4
Links UCSC Browser(chr7:103,350,000-104,070,000)
NCBI Entrez Gene(23966)
IGTC(Tenm4, 5861)
UniGene(Mm.254610)
MGI(2447063)
KEGG GENES(mmu:23966)
EST Profile(Mm.254610)
Other clone traped this gene
21-T402, 21-W111, 21-W258, 21-W260, 21-W81
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB562511 GSS Location chr7:103,503,866-103,585,368 Size 212
Sequence GTAGCGCTAAGCACCGTGCTCGTGAANGATNACCCGAAAGTGGCAGCNTGCAGNCACNATGGACA
GTCTGAGGTGAGAGAGGGCTAGTGATTTCTCGGACACTTGGGCAGTAGAACCCATACCACCCTGT
TCTCTGGGATCCGATGGCCTTGGAGAGGGGGCTGCAGGGCCCGAGGACACCAACTCTTCCCAGAG
CGCTGGCATGGAGCCAG
Links UCSC Browser(chr7:103,503,866-103,585,368)
IGTC(Ayu21-W453)

Homology Search Results

[BB620765] BB620765 RIKEN full-length enriched, 13 days embryo male testis Mus musculus cDNA clone 6030416D17 5-, mRNA sequence gi|16459702|dbj|BB620765.1|[16459702]

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for Tenm4)

<Return to clone list