Topics

<Return to clone list

ID  21-W471
Registered  2010.11.23    Last Update  2020.06.02
Gene Name EST Gene Symbol EST
Chromosome 13 Genomic Location
Synonyms
Links UCSC Browser
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB601828 GSS Location Size 284
Sequence GTGGCTGGCAGGCTTGAATGGTTCTCTGTGTTCTGCTCTGAGATCTTCTGTTGGGTGCATTGAGG
GGACCTCAGGAAGCTCTGAGATTTAGACATGGATGCAGTGACTTTTGACGATGTGCATGTGAATT
TCACTAAAGAAGAATGGAATTTGATGGATCCTTCCCAGATGAATCTCTACAAAGATGTTATGTTG
GAGACCTACTGGAACCTTACTTCTATAGGCTACAAATGGGAAGACCATCATATTGAAGAATCATG
TCAAAGTTCTCGAAGACATACAAG
Links UCSC Browser
IGTC

Homology Search Results

[NM_183119] Mus musculus RIKEN cDNA 2410141K09 gene (2410141K09Rik), mRNA.

Mouse Information

Card ID 2868 Strain Name B6;CB-Gt(pU-21W)471Card
Internal Code Ayu21-W471
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for EST)

<Return to clone list