Topics

<Return to clone list

ID  21-W475
Registered  2010.07.31    Last Update  2018.10.27
Gene Name New Gene Symbol New
Chromosome Unknown Genomic Location
Synonyms AA675336, AI507533, 1300012G03Rik, 4833415K22Rik
Links UCSC Browser
NCBI Entrez Gene(15925)
IGTC(New, 9637)
UniGene(Mm.28366)
MGI(96412)
KEGG GENES(mmu:15925)
EST Profile(Mm.28366)
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB573681 GSS Location Size 141
Sequence CAAAAGGAAGCGTTCGCCGAGATCGCAGCGGCTGCGCCGGGGTATGCGGAACGGGCTCGTGTGGC
TGCTGCACCCCGCGCTGCCCGGCACCTTGCGCTCCATCCTCGGCGCCCGCCCGCCGCCCGCGAAG
CGACTGTGTGG
Links UCSC Browser
IGTC(Ayu21-W475)

Homology Search Results

[AJ278422] Mus musculus mRNA for insulin degrading enzyme (Ide gene).

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for New)

<Return to clone list