Topics

<Return to clone list

ID  21-W480
Registered  2010.07.03    Last Update  2018.10.27
Gene Name WD repeat domain 20 Gene Symbol Wdr20
Chromosome 12 Genomic Location chr12:111,975,000-112,043,000
Synonyms Wdr20a, WDR20, AI549910, 2310040A13Rik
Links UCSC Browser(chr12:111,975,000-112,043,000)
NCBI Entrez Gene(69641)
IGTC(Wdr20, 6619)
UniGene(Mm.435546)
MGI(1916891)
KEGG GENES(mmu:69641)
EST Profile(Mm.435546)
Other clone trapped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB570401 GSS Location chr12:111,976,214-111,976,487 Size 275
Sequence GGCAGGATGAACGCTGCTTTCCAAGATGGCGACGGAGGGAGGAGGGAAGGAGATGAACGAGATTA
AGACCCAATTCACCACCCGGGAAGGTCTGTACAAGCTGCTGCAGCACTCGGAGTACAAGCCGGCC
CAACCGGGTGCCCTTCAACTCGCAGGGATCCAACCCTGTCCGCGTCTCCTTCGTAAACCTCAACG
ACCAGTCTGGCAACGGCGACCGCCTCTGCTTCAATGTGGGCCGGGAGCTCTACTTCTATATCTAC
AAGGGGGTCCGCAAG
Links UCSC Browser(chr12:111,976,214-111,976,487)
IGTC(Ayu21-W480)

Homology Search Results

[NM_027149] Mus musculus WD repeat domain 20A (Wdr20a), mRNA.

Mouse Information

Card ID 1759 Strain Name B6;CB-Wdr20aGt(pU-21W)480Card
Internal Code Ayu21-W480
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Wdr20)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list