Topics

<Return to clone list

ID  21-W492
Registered  2010.07.15    Last Update  2020.06.02
Gene Name EST Gene Symbol EST
Chromosome 3 Genomic Location chr3:19,822,238-19,845,997
Synonyms Ayu21-KBW53
Links UCSC Browser(chr3:19,822,238-19,845,997)
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB571316 GSS Location chr3:19,834,065-19,834,161 Size 97
Sequence CCAGGTCTCCATATGCTCAGTCAAATCTCCATAACTGTAAATCAACACTAAGAGCACTGGATAGT
TAAAGTCAAGGAGACTCTCACAAAGGATCCAG
Links UCSC Browser(chr3:19,834,065-19,834,161)
IGTC(Ayu21-W492)

Homology Search Results

[CF896815] A0215H10-5 NIA Mouse Embryonic Germ Cell cDNA Library (Long, subtracted) Mus musculus cDNA clone NIA:A0215H10 IMAGE:30729885 5', mRNA sequence.

Mouse Information

Card ID 2869 Strain Name B6;CB-Gt(pU-21W)492Card
Internal Code Ayu21-W492
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for EST)

<Return to clone list