| Topics |
ID 21-W494
| Gene Name | prolyl 4-hydroxylase, beta polypeptide | Gene Symbol | P4hb | ||||
|---|---|---|---|---|---|---|---|
| Chromosome | 11 | Genomic Location | chr11:120,421,000-120,435,000 | ||||
| Synonyms | ERp59, PDI, Pdia1, protein disulfide isomerase, Thbp | ||||||
| Links | UCSC Browser(chr11:120,421,000-120,435,000) NCBI Entrez Gene(18453) IGTC(P4hb, 11983) UniGene(Mm.16660) |
MGI(97464) KEGG GENES(mmu:18453) EST Profile(Mm.16660) |
|||||
| Other clone trapped this gene |
|---|
| Trap vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
|---|---|---|---|---|---|
| Accession | AB571318 | GSS Location | chr11:120,433,971-120,434,187 | Size | 217 |
| Sequence | GCTCTCGTCGCCTTGGCTGTCCCGGCGGCGCCAACCCAACTGCCCCGCCCGCTGCAGACGTCCGA CATGCTGAGCCGTGCTTTGCTGTGCCTAGCCCTGGCCTGGGCGGCTAGGGTGGGCGCCGACGCCC TGGAGGAGGAGGACAACGTCCTGGTGTTGAAGAAGAGCAACTTCGAGGAGGCGCTGGCGGCGCAC AAGTACCTGCTGGTGGAGTTCT |
||||
| Links | UCSC Browser(chr11:120,433,971-120,434,187) IGTC(Ayu21-W494) |
||||
Homology Search Results
| [NM_011032] Mus musculus prolyl 4-hydroxylase, beta polypeptide (P4hb), mRNA. |
Mouse Information
| Card ID | 2084 | Strain Name | B6;CB-P4hbGt(pU-21W)494Card |
|---|---|---|---|
| Internal Code | Ayu21-W494 | ||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||
| Links |
IMSR (for P4hb) |
||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |