Topics

<Return to clone list

ID  21-W494
Registered  2010.07.15    Last Update  2019.06.16
Gene Name prolyl 4-hydroxylase, beta polypeptide Gene Symbol P4hb
Chromosome 11 Genomic Location chr11:120,421,000-120,435,000
Synonyms ERp59, PDI, Pdia1, protein disulfide isomerase, Thbp
Links UCSC Browser(chr11:120,421,000-120,435,000)
NCBI Entrez Gene(18453)
IGTC(P4hb, 11983)
UniGene(Mm.16660)
MGI(97464)
KEGG GENES(mmu:18453)
EST Profile(Mm.16660)
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB571318 GSS Location chr11:120,433,971-120,434,187 Size 217
Sequence GCTCTCGTCGCCTTGGCTGTCCCGGCGGCGCCAACCCAACTGCCCCGCCCGCTGCAGACGTCCGA
CATGCTGAGCCGTGCTTTGCTGTGCCTAGCCCTGGCCTGGGCGGCTAGGGTGGGCGCCGACGCCC
TGGAGGAGGAGGACAACGTCCTGGTGTTGAAGAAGAGCAACTTCGAGGAGGCGCTGGCGGCGCAC
AAGTACCTGCTGGTGGAGTTCT
Links UCSC Browser(chr11:120,433,971-120,434,187)
IGTC(Ayu21-W494)

Homology Search Results

[NM_011032] Mus musculus prolyl 4-hydroxylase, beta polypeptide (P4hb), mRNA.

Mouse Information

Card ID 2084 Strain Name B6;CB-P4hbGt(pU-21W)494Card
Internal Code Ayu21-W494
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for P4hb)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list