Topics

<Return to clone list

ID  21-W516
Registered  2010.07.15    Last Update  2011.10.17
Gene Name cDNA sequence BC052040 Gene Symbol BC052040
Chromosome 2 Genomic Location chr2:115,406,000-115,610,000
Synonyms MGC62402, RP23-297K24.1
Links UCSC Browser(chr2:115,406,000-115,610,000)
NCBI Entrez Gene(399568)
IGTC(BC052040, 5883)
UniGene(Mm.134929)
MGI(3026886)
KEGG GENES(mmu:399568)
EST Profile(Mm.134929)
Other clone trapped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB571328 GSS Location chr2:115,407,487-115,407,721 Size 236
Sequence GGGGGGGTGTGCTTTGGGGGCATAAGGGATAGCTAAATAAGTGGAGGGCCCAGGGTCGTACCGCG
CTCTGCCCTTCCCTAGGTTCTAGGCACCAAGCCCGCACGAGCCCAAGGGTGATTTTTCCTTGGGC
CCAATATGATACTAACCAAAGCCCAGTACGAGGAGATAGCCCAGTGCCTAGTGTCTGTACCGCCC
ACTAGGCAGAGCCTGAGGAAGCTGAAGCAGAGGTTCCCCAG
Links UCSC Browser(chr2:115,407,487-115,407,721)
IGTC(Ayu21-W516)

Homology Search Results

[NM_207264] Mus musculus cDNA sequence BC052040 (BC052040), transcript variant 2, mRNA.

Mouse Information

Card ID 1781 Strain Name B6;CB-BC052040Gt(pU-21W)516Card
Internal Code Ayu21-W516
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for BC052040)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list