Topics

<Return to clone list

ID  21-W521
Registered  2010.07.20    Last Update  2019.04.16
Gene Name erythroid differentiation regulator 1 Gene Symbol Erdr1
Chromosome Y Genomic Location
Synonyms edr, MGC5764
Links UCSC Browser
NCBI Entrez Gene(170942)
IGTC
UniGene(Mm.391385)
MGI(2384747)
KEGG GENES(mmu:170942)
EST Profile(Mm.391385)
Other clone traped this gene
21-KBT47, 21-T47, 21-KBW221, 21-KBW177, 21-W14, 21-KBW106, 21-KBW112, 21-KBW113, 21-KBW116, 21-KBW178, 21-KBW183, 21-W347, 21-KBW154, 21-W442, 21-KBW209, 21-KBW241, 21-KBW252, 21-B173, 21-7, 21-62
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB572054 GSS Location Size 90
Sequence TGTCACCCACGAAAGCACACACGTAGAAGCGGACGCCGTGGTCAAGATGTCTCTGCCATCCCCAC
AGGACGGACGGACGGACTCCACAAG
Links UCSC Browser
IGTC(Ayu21-W521)

Homology Search Results

[CR536618] Mouse DNA sequence from clone RP24-143B12 on chromosome X, complete sequence.

Mouse Information

Card ID 2748 Strain Name B6;CB-Erdr1Gt(pU-21W)521Card
Internal Code Ayu21-W521
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Erdr1)

<Return to clone list