| Topics |
ID 21-W551
| Gene Name | zinc finger protein 976 | Gene Symbol | Zfp976 | ||||
|---|---|---|---|---|---|---|---|
| Chromosome | 7 | Genomic Location | chr7:50,071,000-50,124,000 | ||||
| Synonyms | 9830147E19Rik, C330019L16Rik | ||||||
| Links | UCSC Browser(chr7:50,071,000-50,124,000) NCBI Entrez Gene(208111) IGTC(Zfp976, 3466) UniGene(Mm.387841) |
MGI(3036263) KEGG GENES(mmu:208111) EST Profile(Mm.387841) |
|||||
| Other clone trapped this gene |
|---|
| Trap vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
|---|---|---|---|---|---|
| Accession | AB601837 | GSS Location | chr7:50,122,494-50,122,618 | Size | 125 |
| Sequence | CCGGTCTCCCTGCTGCTGGTTCCATGTTGTAGCTGAGGAGAATGGAGTGGTTTGTGTGTCCTGCT CTGTGTGCTACTGCTGGATGCTGAGAGGGAAATTCAGGCGAGCTCTGACTTCGCGACATG |
||||
| Links | UCSC Browser(chr7:50,122,494-50,122,618) IGTC(Ayu21-W551) |
||||
Homology Search Results
| [AK049289] Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:C330019L16 product:hypothetical protein, full insert sequence. |
Mouse Information
| Card ID | Strain Name | ||
|---|---|---|---|
| Internal Code | |||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||
| Links |
IMSR (for Zfp976) |
||