Topics

<Return to clone list

ID  21-W572
Registered  2010.08.08    Last Update  2011.09.18
Gene Name coiled-coil domain containing 88C Gene Symbol Ccdc88c
Chromosome 12 Genomic Location chr12:102,148,000-102,270,000
Synonyms Daple, AV000935, AW324073, mKIAA1509, 0610010D24Rik
Links UCSC Browser(chr12:102,148,000-102,270,000)
NCBI Entrez Gene(68339)
IGTC(Ccdc88c, 5970)
UniGene(Mm.156217)
MGI(1915589)
KEGG GENES(mmu:68339)
EST Profile(Mm.156217)
Other clone trapped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB575997 GSS Location chr12:102,260,504-102,267,092 Size 321
Sequence GCCCGCCGCCGGCTGCCGGAGCCGCTTTGTGCGGCGCGGCCGCGGCTCAGCATGGACGTGACGGT
GTCGCAGCTCGTTGAGCTGTTTCTGCAGAGCCCGCTGGTGACCTGGGTGAAAACTTTTGGATCGT
TTGGAAGCGGCCACCAGGACAACTTGACTCTGTACATGGATTTAGTGGACGGCATCTTTTTGAAT
CAAATCATGCTGCAAATAGACCCCAGGCCCAGCAATCAGCGCATCAACAAGCATGTCAACAATGA
CGTCAACCTGCGTATCCAAAACCTGAGTATCCTGGTGAGAAACATCAAGACCTACTACCAG
Links UCSC Browser(chr12:102,260,504-102,267,092)
IGTC(Ayu21-W572)

Homology Search Results

[NM_026681] Mus musculus coiled-coil domain containing 88C (Ccdc88c), mRNA.

Mouse Information

Card ID 1804 Strain Name B6;CB-Ccdc88cGt(pU-21W)572Card
Internal Code Ayu21-W572
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Ccdc88c)

<Return to clone list