Topics

<Return to clone list

ID  21-W74
Registered  2008.04.30    Last Update  2010.11.11
Gene Name FK506 binding protein 4 Gene Symbol Fkbp4
Chromosome 6 Genomic Location chr6:128,379,000-128,389,000
Synonyms FKPB52, 59kDa, p59, FKBP-52
Links UCSC Browser(chr6:128,379,000-128,389,000)
NCBI Entrez Gene(14228)
IGTC(Fkbp4, 2436)
UniGene(Mm.12758)
MGI(95543)
KEGG GENES(mmu:14228)
EST Profile(Mm.12758)
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB435413 GSS Location chr6:128,384,323-128,388,539 Size 682
Sequence GCCCAGCGGCCATGACCGCCGAGGAGATGAAGGCGGCGGAGAACGGGGCGCAGTCGGCGCCCCTG
CCTCTCGAAGGAGTGGACATCAGCCCCAAACAGGACGAGGGCGTGCTCAAGGTCATCAAGAGAGA
GGGTACAGGCACAGAGACACCCATGATCGGGGACCGAGTCTTTGTCCACTACACTGGCTGGCTGC
TAGATGGCACAAAGTTTGACTCCAGTNTGGACCGCAAGGACAAATTNTCCTTTGACCTGGGAAAA
GGGGAGGTCATCAAGGCTTGGGATATTGCTGTGGCAACCATGAAAGTGGGGGAAGTGTGCCACAT
CACCTGCAAGCCAGAATATGCCTATGGCGCAGCAGGCAGCCCTCCGAAGATCCCCCCCAACGCCA
CACTTGTATTTGAGGTGGAGCTGTTTGAGTTCAAAGGAGAAGATCTTACAGAAGAAGAAGATGGC
GGGATCATCCGCAGAATACGGACTCGGGGTGAAGGCTATGCCAGGCCCAATGATGGTGCTATGGT
GGAAGTGGCCCTGGAAGGCTACCACAAGGACCGCCTCTTTGACCAGCGGGAGCTCTGCTTTGAAG
TCGGGGAAGGGGAAAGTCTAGATCTGCCCTGTGGGCTGGAGGAGGCCATTCAGCGCATGGAGAAA
GGAGAGCATTCCATCGTGTACCTCAAACCTAG
Links UCSC Browser(chr6:128,384,323-128,388,539)
IGTC(Ayu21-W74)

Homology Search Results

Mouse Information

Card ID 1179 Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Fkbp4)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list