Topics

<Return to clone list

ID  21-W79
Registered  2008.11.05    Last Update  2018.10.28
Gene Name New Gene Symbol New
Chromosome Unlocalized Genomic Location
Synonyms
Links UCSC Browser
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB469152 GSS Location Size 148
Sequence GAGAGGTGTTCAGCAGCCTCTGGTTCTATTTGTACCTTCAAAATCTACACAAGGCTGGACTAACC
TGAAGGAGTAANCAGGAATCCTCAAGGANCACACANTGTCCATGGAATANTTCCACCAAAGATAT
ATTCGGAAGNTCTATAAG
Links UCSC Browser
IGTC

Homology Search Results

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for New)

<Return to clone list