| Topics |
ID 21-W81
| Gene Name | teneurin transmembrane protein 4 | Gene Symbol | Tenm4 | ||||
|---|---|---|---|---|---|---|---|
| Chromosome | 7 | Genomic Location | chr7:103,350,000-104,070,000 | ||||
| Synonyms | Odz4, l7Rn3, ELM2, Ten-m4, l(7)-3Rn, Doc4 | ||||||
| Links | UCSC Browser(chr7:103,350,000-104,070,000) NCBI Entrez Gene(23966) IGTC(Tenm4, 5861) UniGene(Mm.254610) |
MGI(2447063) KEGG GENES(mmu:23966) EST Profile(Mm.254610) |
|||||
| Other clone trapped this gene |
|---|
| 21-T402, 21-W111, 21-W258, 21-W260, 21-W453 |
| Trap vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
|---|---|---|---|---|---|
| Accession | AB444047 | GSS Location | chr7:103,360,415-103,503,921 | Size | 142 |
| Sequence | TAAGCTGCCTCAGTGATCTCCCAGATCTGTATTGCAAGCACCCGGCTCTTGAAAGACAACCCTGA AAGTTTTACTGCTTGGGGACTATGGACAGTCTGAGGCTGAGAGAGGGCTAGTGATTTCTCGGACA CTTGGGCAGTAG |
||||
| Links | UCSC Browser(chr7:103,360,415-103,503,921) IGTC(Ayu21-W81) |
||||
Homology Search Results
| [BB620765] BB620765 RIKEN full-length enriched, 13 days embryo male testis Mus musculus cDNA clone 6030416D17 5-, mRNA sequence gi|16459702|dbj|BB620765.1|[16459702] |
| [AK147579] Mus musculus cDNA, RIKEN full-length enriched library, clone:M5C1082H18 product:odd Oz/ten-m homolog 4 (Drosophila), full insert sequence. |
Mouse Information
| Card ID | 1198 | Strain Name | |
|---|---|---|---|
| Internal Code | |||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. We could detect splice variants in 5'-RACE products. | ||
| Links |
IMSR (for Tenm4) |
||