Topics

<Return to clone list

ID  21-W81
Registered  2008.06.30    Last Update  2018.10.28
Gene Name teneurin transmembrane protein 4 Gene Symbol Tenm4
Chromosome 7 Genomic Location chr7:103,350,000-104,070,000
Synonyms Odz4, l7Rn3, ELM2, Ten-m4, l(7)-3Rn, Doc4
Links UCSC Browser(chr7:103,350,000-104,070,000)
NCBI Entrez Gene(23966)
IGTC(Tenm4, 5861)
UniGene(Mm.254610)
MGI(2447063)
KEGG GENES(mmu:23966)
EST Profile(Mm.254610)
Other clone trapped this gene
21-T402, 21-W111, 21-W258, 21-W260, 21-W453
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB444047 GSS Location chr7:103,360,415-103,503,921 Size 142
Sequence TAAGCTGCCTCAGTGATCTCCCAGATCTGTATTGCAAGCACCCGGCTCTTGAAAGACAACCCTGA
AAGTTTTACTGCTTGGGGACTATGGACAGTCTGAGGCTGAGAGAGGGCTAGTGATTTCTCGGACA
CTTGGGCAGTAG
Links UCSC Browser(chr7:103,360,415-103,503,921)
IGTC(Ayu21-W81)

Homology Search Results

[BB620765] BB620765 RIKEN full-length enriched, 13 days embryo male testis Mus musculus cDNA clone 6030416D17 5-, mRNA sequence gi|16459702|dbj|BB620765.1|[16459702]
[AK147579] Mus musculus cDNA, RIKEN full-length enriched library, clone:M5C1082H18 product:odd Oz/ten-m homolog 4 (Drosophila), full insert sequence.

Mouse Information

Card ID 1198 Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. We could detect splice variants in 5'-RACE products.
Links IMSR (for Tenm4)

<Return to clone list