Topics

<Return to clone list

ID  21-W84
Registered  2008.04.30    Last Update  2020.05.03
Gene Name New Gene Symbol New
Chromosome 16 Genomic Location chr16:3,345,516-3,353,188
Synonyms
Links UCSC Browser(chr16:3,345,516-3,353,188)
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB435417 GSS Location chr16:3,345,582-3,346,048 Size 491
Sequence CAACGATAATTGTCAAATGCCCATCCTGGTGAGAACCACATTTACTGATTAAAATGCATAAAGAC
CAAGTTGCCAGAAGGGGACTCCAAACATCTTTATATTTCATTTCTTGAGTTGGGACCTTCTGTTT
GTTTTCCCNTGTTTTTTGTTAGTTTGTTTTTCTGACGCATGGCATTTTTACGTAGTTGTCCNTGA
ACTGACATTGTAGACTGGGCTGGTCTTGAATTCAGAGATTTGCCGGCCTCCACCTTCTAAGTGTT
GGCTGCAAGAATCTGGTTTTGGGAGGGGCTAAAGTCTCATGTTGAGAGACGCTATCATGCATGTC
ACGAGTTAGTATTTTGGGAGAGGTGTTCAGCAGCCTCNGGTTCTATCTGTACCTTCAAAATCTAC
ACAAGGCTGGNCTAACCTGAAGGAGTAAACAGGAATCTCAGGGAGCACACAGTGGCCATGGAATA
CTTCCACCAAAGCATATATTCGGAAGGTACTATAAG
Links UCSC Browser(chr16:3,345,582-3,346,048)
IGTC

Homology Search Results

[CC326788] RRI199 BayGenomics Gene Trap Library pGT0Lxf Mus musculus cDNA, mRNA sequence.

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for New)

<Return to clone list