| Topics |
ID 21-W85
| Gene Name | ubiquitin-conjugating enzyme E2N | Gene Symbol | Ube2n | ||||
|---|---|---|---|---|---|---|---|
| Chromosome | 10 | Genomic Location | chr10:94,977,000-95,010,000 | ||||
| Synonyms | UBC13 | ||||||
| Links | UCSC Browser(chr10:94,977,000-95,010,000) NCBI Entrez Gene(93765) IGTC(Ube2n, 15170) UniGene(Mm.371667) |
MGI(1934835) KEGG GENES(mmu:93765) EST Profile(Mm.371667) |
|||||
| Other clone trapped this gene |
|---|
| Trap vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
|---|---|---|---|---|---|
| Accession | AB435418 | GSS Location | chr10:94,977,779-94,977,871 | Size | 94 |
| Sequence | ACTCGAGCGTGAGGAGAGCGGAGCCGGAGACAAGAGCAGAGGCCGAACTCGGGATCTGACAAGAT GGCCGGGCTGCCCCGCAGGGATCATCAAG |
||||
| Links | UCSC Browser(chr10:94,977,779-94,977,871) IGTC(Ayu21-W85) |
||||
Homology Search Results
| [AK005302] Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched library, clone:1500026J17 product:ubiquitin-conjugating enzyme E2N, full insert sequence. |
Mouse Information
| Card ID | 1368 | Strain Name | B6;CB-Ube2nGt(pU-21W)85Card |
|---|---|---|---|
| Internal Code | Ayu21-W85 | ||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||
| Links |
IMSR (for Ube2n) |
||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |