Topics

<Return to clone list

ID  21-W85
Registered  2008.04.30    Last Update  2011.04.14
Gene Name ubiquitin-conjugating enzyme E2N Gene Symbol Ube2n
Chromosome 10 Genomic Location chr10:94,977,000-95,010,000
Synonyms UBC13
Links UCSC Browser(chr10:94,977,000-95,010,000)
NCBI Entrez Gene(93765)
IGTC(Ube2n, 15170)
UniGene(Mm.371667)
MGI(1934835)
KEGG GENES(mmu:93765)
EST Profile(Mm.371667)
Other clone trapped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB435418 GSS Location chr10:94,977,779-94,977,871 Size 94
Sequence ACTCGAGCGTGAGGAGAGCGGAGCCGGAGACAAGAGCAGAGGCCGAACTCGGGATCTGACAAGAT
GGCCGGGCTGCCCCGCAGGGATCATCAAG
Links UCSC Browser(chr10:94,977,779-94,977,871)
IGTC(Ayu21-W85)

Homology Search Results

[AK005302] Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched library, clone:1500026J17 product:ubiquitin-conjugating enzyme E2N, full insert sequence.

Mouse Information

Card ID 1368 Strain Name B6;CB-Ube2nGt(pU-21W)85Card
Internal Code Ayu21-W85
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Ube2n)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list