Topics

<Return to clone list

ID  21-W888
Registered  2013.06.16    Last Update  2018.10.29
Gene Name RIKEN cDNA 9430038I01 gene Gene Symbol 9430038I01Rik
Chromosome 7 Genomic Location chr7:144,565,000-144,606,000
Synonyms
Links UCSC Browser(chr7:144,565,000-144,606,000)
NCBI Entrez Gene(77252)
IGTC(9430038I01Rik, 23423)
UniGene(Mm.29184)
MGI(1924502)
KEGG GENES(mmu:77252)
EST Profile(Mm.29184)
Other clone traped this gene
21-T252
Trap vector pU-21W Cell Line KTPU8 Method 5'-Inverse PCR
Accession AB827440 GSS Location chr7:144,583,088-144,583,392 Size 305
Sequence GTGGGTCCAAAATCCAGCAATGAAGGCTTTGGGAAATAGAACTTTTCCCAAGTGTTACTTGGGAA
ATAGCCACTCTCAAATGGTCTTTGATGAAATGACTTGTGTGTTTTATTCAGTATGGACAGGGACT
GTATAAACCTTGAGGAGTAGGGTGGGGTGTAGGGGGGTAGGTGTTTCCCATTGGCTGAGTTTGAG
ATGTTAGTGATAAGACTCCAGGTGTGACTTTCCAGCGGCTGTCTATCTGCCCAGGGTCCTCTCAG
TGGGCTGTTGTGGTTACTTGTTCCGGAGCAGGTATAGAGACAGTT
Links UCSC Browser(chr7:144,583,088-144,583,392)
IGTC

Homology Search Results

[AK078159] Mus musculus adult male medulla oblongata cDNA, RIKEN full-length enriched library, clone:6330584I18 product:RIKEN cDNA 9430038I01 gene, full insert sequence.

Mouse Information

Card ID 2019 Strain Name B6;CB-9430038I01RikGt(pU-21W)888Card
Internal Code Ayu21-W888
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for 9430038I01Rik)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list