Topics

<Return to clone list

ID  21-W92
Registered  2008.04.24    Last Update  2018.10.29
Gene Name 45S rRNA gene Gene Symbol 45SrRNA
Chromosome Unlocalized Genomic Location
Synonyms
Links UCSC Browser
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
21-W237, 21-27, 21-77, 21-111, 21-40, 21-B105, 21-B197, 21-T25, 21-B170, 21-B150, 21-T22, 21-T42, 21-T90, 21-T110, 21-T1, 21-B203, 21-KBW171, 21-T184, 21-B121, 21-T109, 21-T185, 21-T189, 21-T339, 21-T204, 21-T211, 21-B136, 21-T428, 21-T454, 21-T103, 21-T482, 21-W70, 21-T111, 21-MT90, 21-W100, 21-W130, 21-T284, 21-W137, 21-W212, 21-W264, 21-MT61, 21-KBW217, 21-W332, 21-T302, 21-MT31, 21-MT45, 21-W325, 21-W342, 21-W369, 21-W381, 21-W531, 21-W547, 21-W555, 21-MT38, 21-T205, 21-T267, 21-MT50, 21-MT40, 21-MT53, 21-MT79, 21-MT142, 21-MT110, 21-MT114, 21-B187, 21-B199
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB435175 GSS Location Size 112
Sequence GGCCCTTGAAAATACCGGGGGAGAGGGTGTAAATACTCGCGCCGGGCCGTACCCATATACCGCAG
CAGGTGCTCCAAGGTGAACAGCCTNCTGGCATGTTGGAACAATGTAG
Links UCSC Browser
IGTC

Homology Search Results

[X82564] M.musculus 45S pre rRNA gene.

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for 45SrRNA)

<Return to clone list