Topics

<Return to clone list

ID  21-W94
Registered  2008.04.30    Last Update  2018.10.29
Gene Name La ribonucleoprotein domain family, member 4B Gene Symbol Larp4b
Chromosome 13 Genomic Location chr13:9,092,000-9,175,000
Synonyms Larp5, AI256361, D13Wsu64e, A630096F19, MGC78318
Links UCSC Browser(chr13:9,092,000-9,175,000)
NCBI Entrez Gene(217980)
IGTC(Larp4b, 10440)
UniGene(Mm.234944)
MGI(106330)
KEGG GENES(mmu:217980)
EST Profile(Mm.234944)
Other clone traped this gene
Trap vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB435421 GSS Location chr13:9,093,158-9,123,208 Size 450
Sequence GTGTGTTCTCATGCGAACGGGAAGGAGCGTTGGGGATCTGGAGTCTCGAGGTTGAGACATTTTCG
GGCCCGAAAAAGGAAGGATCGGCTGCCGTCGCTGCCAAGTCCGCGCCCGCTCTTCTTTGCTGTCT
CCGGCCCGGCCCGGCCGTGCCGCCTTTTCTTGCCGTCTCCCTCCTCGGCCGTCCCCGCGTGTTTT
GCGCGGTCGCCGGGCACCGGGGCTGCGGCGACGAGCCCGCGGGCGGCCGGTCGGGCGGGGCGGGC
GGCTGACAGCGTCCTGAGGTTAGCATTATACTTTTCCAGTGGAGCCCATGACTTCTGATCAGGAC
GCTAAAGTTGTGGCTGAACCGCAGGCACAGCGAGTCCAGGAGGGCAAGGACAGCTCTCATACTGA
TGAATGGTCCTATATCGCAAACCACTTCTCAAACAAGGTCCCTCCCAGACTTTGANTCAG
Links UCSC Browser(chr13:9,093,158-9,123,208)
IGTC(Ayu21-W94)

Homology Search Results

[AK080953] Mus musculus 4 days neonate male adipose cDNA, RIKEN full-length enriched library, clone:B430217H13 product:weakly similar to C-MPL BINDING PROTEIN [Homo sapiens], full insert sequence.

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for Larp4b)

<Return to clone list