Topics

<Return to clone list

ID  K9E04
Registered  2013.10.02    Last Update  2018.10.30
Gene Name NKAP domain containing 1 Gene Symbol Nkapd1
Chromosome 9 Genomic Location chr9:50,412,661-50,426,172
Synonyms AU019823, Gm639
Links UCSC Browser(chr9:50,412,661-50,426,172)
NCBI Entrez Gene(270156)
IGTC(Nkapd1, 10077)
UniGene(Mm.335149)
MGI(2143205)
KEGG GENES(mmu:270156)
EST Profile(Mm.335149)
Other clone traped this gene
Trap vector pCMT-SAhygpA-NP21 Cell Line vdR2-4 Method Splinkerette PCR
Accession AB735726 GSS Location chr9:50,424,382-50,424,694 Size 313
Sequence GGTTTTGGAAAGTTCCGTACAGTGTAGGAAACAAAATGTCCTGAGTAGAGATATTTAGGTCATCT
AAAAACTTTTTTACAATTCAGTTTATTTTTTTACTGTTGACATACGTGGTGTTTGATGCCTTCAA
ATCTTCGTGTTTATATCTTTGCAAGCGAATTTTGGGGAGTTTTGAGATTTGATTTCTAGCCGGGA
CACTAACACACCCGTTGCCTGAGTCCATGCAGCCTGGGGGCAGGTTACGGCTTTAAGGAATTTGA
TTTTGAGGAGTTGGGGTAGAGTCCAAACTCGGGGATCCCCATAGGTTAAAAGG
Links UCSC Browser(chr9:50,424,382-50,424,694)
IGTC(AuK9E04)

Homology Search Results

Mouse Information

Card ID Strain Name
Internal Code
Description This clone was isolated by using the gene trap vector pCMT-SAhygpA-NP21 and the ES cell line vdR2-4. Homozygous mutation was introduced at the vector insertion site by exploiting mitotic recombination induced with transient disruption of the Bloom’s syndrome gene. This double knock out ES cell line was established by Takeda Laboratory at Osaka University, and deposited to the EGTC. Please check Homozygous ES Cell Database. This sequence-tag is genomic sequence of 3'-flanking region obtained by Splinkerette PCR.
[Paper] "A homozygous mutant embryonic stem cell bank applicable for phenotype-driven genetic screening." Horie, K., Kokubu, C., Toshida, J., Akagi, K., Isotani, A., Oshitani, A., Yusa, K., Ikeda, R., Huang, Y., Bradley, A. and Takeda, J., Nature Methods, 8, 1071-1077 (2011). PubMed ID:22020066.
Links IMSR (for Nkapd1)

<Return to clone list