ID 18-45
Registered: 2005.02.07 Last update: 2018.02.13
| Gene Name | Smg-6 homolog, nonsense mediated mRNA decay factor | Gene Symbol | Smg6 | |||
| Chromosome | 11 | Genomic Location | chr11:74,735,000-74,980,000 |  |
||
| Synonyms | AI317223; AU041178 | |||||
| Links |
UCSC Genome Browser(chr11:74,735,000-74,980,000) NCBI Gene(103677) IGTC(Smg6,3026) UNIGene(Mm.288460) |
MGI(2144117) KEGG GENES(mmu:103677) EST Profile(mm.288460) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-18 | Cell Line | KTPU10 | Method | 5'-RACE |
| Accession | AB201547 | GSS Location | chr11:74,739,348-74,739,504 | Size | 155 |
| Sequence | TCGTCCGTCGTGGTTTCCTGGCTGCGCGCGGCGGTGGCCGAGTCGCCGCAGCTGTAGCAGCCGCC GCGAAGATGGCGGAGGGGTTGGAGCGTGTGCGGATCTCCGCATCGGAACTGCGAGGGATCCTGGC CACTTGGTCCGCAGGCCGGGACAGA |
||||
| Links |
UCSC Browser(chr11:74,739,348-74,739,504) IGTC(Ayu18-45) |
||||
Homology Search Results
| [BY710186] Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:2410091G18, 5' end partial sequence. |
Mouse Information
| Card ID | 497 | ||||
| Strain Name | B6;CB-Smg6Gt(pU-18)45Imeg | ||||
| Internal Code | Ayu18-45 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-18, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Smg6) |
||||