Gene Name | Smg-6 homolog, nonsense mediated mRNA decay factor | Gene Symbol | Smg6 | |||
Chromosome | 11 | Genomic Location | chr11:74,735,000-74,980,000 | ![]() |
||
Synonyms | AI317223; AU041178 | |||||
Links |
UCSC Genome Browser(chr11:74,735,000-74,980,000) NCBI Gene(103677) IGTC(Smg6,3026) UNIGene(Mm.288460) |
MGI(2144117) KEGG GENES(mmu:103677) EST Profile(mm.288460) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-18 | Cell Line | KTPU10 | Method | 5'-RACE |
Accession | AB201547 | GSS Location | chr11:74,739,348-74,739,504 | Size | 155 |
Sequence | TCGTCCGTCGTGGTTTCCTGGCTGCGCGCGGCGGTGGCCGAGTCGCCGCAGCTGTAGCAGCCGCC GCGAAGATGGCGGAGGGGTTGGAGCGTGTGCGGATCTCCGCATCGGAACTGCGAGGGATCCTGGC CACTTGGTCCGCAGGCCGGGACAGA |
||||
Links |
UCSC Browser(chr11:74,739,348-74,739,504) IGTC(Ayu18-45) |
[BY710186] Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:2410091G18, 5' end partial sequence. |
Card ID | 497 | ||||
Strain Name | B6;CB-Smg6Gt(pU-18)45Imeg | ||||
Internal Code | Ayu18-45 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-18, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Smg6) |