Gene Name | nuclear receptor co-repressor 1 | Gene Symbol | Ncor1 | |||
Chromosome | 11 | Genomic Location | chr11:62,125,000-62,280,000 | |||
Synonyms | N-CoR, Rxrip13, RIP13, 5730405M06Rik, A230020K14Rik, mKIAA1047 | |||||
Links |
UCSC Genome Browser(chr11:62,125,000-62,280,000) NCBI Gene(20185) IGTC(Ncor1,1714) UNIGene(Mm.271814) |
MGI(1349717) KEGG GENES(mmu:20185) EST Profile(mm.271814) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-18 | Cell Line | KTPU10 | Method | 5'-RACE |
Accession | AB212667 | GSS Location | chr11:62,153,922-62,154,050 | Size | 133 |
Sequence | CAGTGCCCGGGGTGGATCCCGTCGTGAGTCACAGCCCATTTGATCCTCATCACAGGAGTAGCGCT GCAGGAGAGGTTTATCGGAGCCACCTACCCACGCACTTGGATCCAGCTATGCCCTTTCACAGGGT TGG |
||||
Links |
UCSC Browser(chr11:62,153,922-62,154,050) IGTC(Ayu18-51) |
[L78294] Mus musculus RIP-13 (RIP13) mRNA, complete cds. |
Card ID | 594 | ||||
Strain Name | B6;CB-Ncor1Gt(pU-18)51Imeg | ||||
Internal Code | Ayu18-51 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-18, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Ncor1) |