Gene Name | trinucleotide repeat containing 6b | Gene Symbol | Tnrc6b | |||
Chromosome | 15 | Genomic Location | chr15:80,540,000-80,780,000 | ![]() |
||
Synonyms | 2700090M07Rik, A730065C02Rik, D230019K20Rik, mKIAA1093, AI848765 | |||||
Links |
UCSC Genome Browser(chr15:80,540,000-80,780,000) NCBI Gene(213988) IGTC(Tnrc6b,6697) UNIGene(Mm.131328) |
MGI(2443730) KEGG GENES(mmu:213988) EST Profile(mm.131328) |
Other Clone Trapped This Gene |
---|
21-T306 |
Trap Vector | pU-21 | Cell Line | KTPU10 | Method | 5'-RACE |
Accession | AB187261 | GSS Location | chr15:80,629,036-80,629,234 | Size | 204 |
Sequence | AGAGAGAGAGCAGGAGGGAGAGTGAGCGAGAGAGTTATATCAAGCCAAATTGGCCGATAGAGTCT CTGCTGGTTTCTGAATATTTAAAATACAAAATACAGCTAGACTAAAGGAATTCATTTTATAGGAC CTTTTTTCCATTTCCATTTCTACCTTGAATGCCCTTAATTTCGCTGGATTCAAGCACTGCTGCAA CTTTATTAG |
||||
Links |
UCSC Browser(chr15:80,629,036-80,629,234) IGTC(Ayu21-117) |
[AK051922] Mus musculus 12 days embryo eyeball cDNA, RIKEN full-length enriched library, clone:D230019K20 product:hypothetical Proline-rich region containing protein, full insert sequence. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). We could not establish mouse line from this clone. | ||||
Links |
IMSR (for Tnrc6b) |