ID 21-16
Registered: 2004.06.01 Last update: 2018.03.26
| Gene Name | heat shock protein 8 | Gene Symbol | Hspa8 | |||
| Chromosome | 9 | Genomic Location | chr9:40,609,200-40,613,500 |  |
||
| Synonyms | Hspa10, Hsc73, Hsc70, Hsc71, 70kDa, Hsp73, Hspa10, 2410008N15Rik | |||||
| Links |
UCSC Genome Browser(chr9:40,609,200-40,613,500) NCBI Gene(15481) IGTC(Hspa8,12489) UNIGene(Mm.290774) |
MGI(105384) KEGG GENES(mmu:15481) EST Profile(mm.290774) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21 | Cell Line | KTPU10 | Method | 5'-RACE |
| Accession | AB187233 | GSS Location | chr9:40,609,356-40,609,431 | Size | 86 |
| Sequence | TGGGGAGGCTGGTCTCATTGAACGCGGAGGCAGCTGCCGGGCATTCGTGTGGTCTCGTCGTCAGC GCAGCTGGGCCTACACACAAG |
||||
| Links |
UCSC Browser(chr9:40,609,356-40,609,431) IGTC(Ayu21-16) |
||||
Homology Search Results
| [U73744] Mus musculus heat shock 70 protein (Hsc70) gene, complete cds. |
Mouse Information
| Card ID | 687 | ||||
| Strain Name | B6;CB-Hspa8Gt(pU-21)16Imeg | ||||
| Internal Code | Ayu21-16 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Hspa8) |
||||