ID 21-20
Registered: 2004.06.01 Last update: 2018.04.05
| Gene Name | kelch-like 8 | Gene Symbol | Klhl8 | |||
| Chromosome | 5 | Genomic Location | chr5:104,290,000-104,342,000 |  |
||
| Synonyms | 2310001P09Rik, D5Ertd431e | |||||
| Links |
UCSC Genome Browser(chr5:104,290,000-104,342,000) NCBI Gene(246293) IGTC(Klhl8,19363) UNIGene(Mm.179871) |
MGI(2179430) KEGG GENES(mmu:246293) EST Profile(mm.179871) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21 | Cell Line | KTPU10 | Method | 5'-RACE |
| Accession | AB187237 | GSS Location | chr5:104,340,135-104,340,225 | Size | 91 |
| Sequence | AGCGCGTCCCCGGGGTGTCCAAGCGGGGCTGGCGCGGCGCCGGCGCGGAGCGGGTGTGGCGGCTC GGCCTGCGCGGCGGCCGCGGACAGAG |
||||
| Links |
UCSC Browser(chr5:104,340,135-104,340,225) IGTC(Ayu21-20) |
||||
Homology Search Results
| [AK031028] Mus musculus adult male thymus cDNA, RIKEN full-length enriched library, clone:5832405J12 product:hypothetical BTB/POZ domain containing protein, full insert sequence. |
Mouse Information
| Card ID | 347 | ||||
| Strain Name | B6;CB-Klhl8Gt(Ayu21)20Imeg | ||||
| Internal Code | Ayu21-20 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Klhl8) |
||||