Gene Name | F-box and leucine-rich repeat protein 3 | Gene Symbol | Fbxl3 | |||
Chromosome | 14 | Genomic Location | chr14:103,479,300-103,499,000 | ![]() |
||
Synonyms | Fbl3a, Fbxl3a, Ovtm, FBK, AU041772, AW212966, Play68 | |||||
Links |
UCSC Genome Browser(chr14:103,479,300-103,499,000) NCBI Gene(50789) IGTC(Fbxl3,9811) UNIGene(Mm.214746) |
MGI(1354702) KEGG GENES(mmu:50789) EST Profile(mm.214746) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21 | Cell Line | KTPU10 | Method | 5'-RACE |
Accession | AB187238 | GSS Location | chr14:103,498,573-103,498,736 | Size | 164 |
Sequence | TAACTGGGCCGAAGCTTCGGGCTCGCTGCTGTCGATCGCTGCTCGCCTAGGGCGTCTCGGGCGGG CGACGAGGAGGTGCCGGGGCGAAGGACACAGACCGCGCGGGACAGAGAAGGGACGCGACGCTCTC CTCCCCACACACCGGGGCAGCCGGAGCCGCAAAG |
||||
Links |
UCSC Browser(chr14:103,498,573-103,498,736) IGTC(Ayu21-25) |
[AK080802] Mus musculus adult male corpora quadrigemina cDNA, RIKEN full-length enriched library, clone:B230209E19 product:f-box and leucine-rich repeat protein 3a, full insert sequence. |
Card ID | 456 | ||||
Strain Name | B6;CB-UnknownGt(Ayu21)25Imeg | ||||
Internal Code | Ayu21-25 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Fbxl3) |