ID 21-25
Registered: 2004.07.17 Last update: 2018.04.05
| Gene Name | F-box and leucine-rich repeat protein 3 | Gene Symbol | Fbxl3 | |||
| Chromosome | 14 | Genomic Location | chr14:103,479,300-103,499,000 |  |
||
| Synonyms | Fbl3a, Fbxl3a, Ovtm, FBK, AU041772, AW212966, Play68 | |||||
| Links |
UCSC Genome Browser(chr14:103,479,300-103,499,000) NCBI Gene(50789) IGTC(Fbxl3,9811) UNIGene(Mm.214746) |
MGI(1354702) KEGG GENES(mmu:50789) EST Profile(mm.214746) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21 | Cell Line | KTPU10 | Method | 5'-RACE |
| Accession | AB187238 | GSS Location | chr14:103,498,573-103,498,736 | Size | 164 |
| Sequence | TAACTGGGCCGAAGCTTCGGGCTCGCTGCTGTCGATCGCTGCTCGCCTAGGGCGTCTCGGGCGGG CGACGAGGAGGTGCCGGGGCGAAGGACACAGACCGCGCGGGACAGAGAAGGGACGCGACGCTCTC CTCCCCACACACCGGGGCAGCCGGAGCCGCAAAG |
||||
| Links |
UCSC Browser(chr14:103,498,573-103,498,736) IGTC(Ayu21-25) |
||||
Homology Search Results
| [AK080802] Mus musculus adult male corpora quadrigemina cDNA, RIKEN full-length enriched library, clone:B230209E19 product:f-box and leucine-rich repeat protein 3a, full insert sequence. |
Mouse Information
| Card ID | 456 | ||||
| Strain Name | B6;CB-UnknownGt(Ayu21)25Imeg | ||||
| Internal Code | Ayu21-25 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Fbxl3) |
||||