ID 21-50
Registered: 2005.02.07 Last update: 2006.12.29
| Gene Name | Mouse early transposon ETn | Gene Symbol | ETn | |||
| Chromosome | Unlocalized | Genomic Location | Unlocalized |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(Unlocalized) NCBI Gene() IGTC(ETn,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-MT134, 21-TJH, 21-B142, 21-51, 21-T37, 21-B162, 21-T338, 21-W95, 21-W62, 21-MT64, 21-W331, 21-W326, 21-W571, 21-T246 |
| Trap Vector | pU-21 | Cell Line | KTPU10 | Method | 5'-RACE |
| Accession | AB201546 | GSS Location | Size | 106 | |
| Sequence | TTCTTCTTTTGCCCCGTCTAGATTCCTCTCTTACAGCTCGAGCGGCCTTCTCAGTCGAACCGTTC ACGTTGCGAGCTGCTGGCGGCCACAACATCAAATGCTTTTG |
||||
| Links |
UCSC Browser() IGTC(Ayu21-50) |
||||
Homology Search Results
| [MMY17106] Mus musculus transposon ETn, SELH/L3A strain. |
Mouse Information
| Card ID | 392 | ||||
| Strain Name | B6;CB-GtAyu21-50Imeg | ||||
| Internal Code | Ayu21-50 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for ETn) |
||||