| Gene Name | integrator complex subunit 6 | Gene Symbol | Ints6 | |||
| Chromosome | 14 | Genomic Location | chr14:63,293,000-63,384,000 | |||
| Synonyms | Notch2l, Ddx26, DICE1, 2900075H24Rik | |||||
| Links |
UCSC Genome Browser(chr14:63,293,000-63,384,000) NCBI Gene(18130) IGTC(Ints6,9299) UNIGene(Mm.319684) |
MGI(1202397) KEGG GENES(mmu:18130) EST Profile(mm.319684) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21 | Cell Line | KTPU10 | Method | 5'-RACE |
| Accession | AB187254 | GSS Location | chr14:63,378,038-63,378,073 | Size | 40 |
| Sequence | TCGTAATAGATTAGTAACTGGCATAGACAACTATGGGCAG | ||||
| Links |
UCSC Browser(chr14:63,378,038-63,378,073) IGTC(Ayu21-97) |
||||
| [E37827] Novel carcinostatic gene, protein encoded thereby and methods for producing and utilizing the same. |
| Card ID | 522 | ||||
| Strain Name | B6;CB-UnknownGt(Ayu21)97Imeg | ||||
| Internal Code | Ayu21-97 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Ints6) |
||||