ID 21-MT102
Registered: 2013.02.25 Last update: 2018.05.29
| Gene Name | cellular nucleic acid binding protein | Gene Symbol | Cnbp | |||
| Chromosome | 6 | Genomic Location | chr6:87,792,476-87,801,286 |  |
||
| Synonyms | Znf9 | |||||
| Links |
UCSC Genome Browser(chr6:87,792,476-87,801,286) NCBI Gene(12785) IGTC(Cnbp,2610) UNIGene(Mm.290251) |
MGI(88431) KEGG GENES(mmu:12785) EST Profile(mm.290251) |
||||
| Other Clone Trapped This Gene |
|---|
| K7H06 |
| Trap Vector | pU-21T | Cell Line | Mol/MSM-1 | Method | 5'-RACE |
| Accession | AB695301 | GSS Location | chr6:87,800,898-87,801,043 | Size | 147 |
| Sequence | CGTGCGCAAGCGGCGTGTGTGGGGCCGTGTGCAGACCCGCGTGTGGCGCAGGCAAGGACCCTGAA AATAAACAGCCGCTGCTTTGCGAGTCGCCTTCTTGGTTCTTCGTCCGAGTCTCCTCCGCTGTGGG CAGCTCAGACGCCGAAG |
||||
| Links |
UCSC Browser(chr6:87,800,898-87,801,043) IGTC() |
||||
Homology Search Results
| [NM_001109746] Mus musculus cellular nucleic acid binding protein (Cnbp), transcript variant 3, mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and ES cell line; Mol/MSM-1. This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Cnbp) |
||||