ID 21-MT111
Registered: 2013.02.25 Last update: 2018.05.29
| Gene Name | zinc finger protein 57 | Gene Symbol | Zfp57 | |||
| Chromosome | 17 | Genomic Location | chr17:37,137,952-37,147,910 |  |
||
| Synonyms | G19 | |||||
| Links |
UCSC Genome Browser(chr17:37,137,952-37,147,910) NCBI Gene(22715) IGTC(Zfp57,4129) UNIGene(Mm.305561) |
MGI(99204) KEGG GENES(mmu:22715) EST Profile(mm.305561) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | Mol/MSM-1 | Method | 5'-RACE |
| Accession | AB695306 | GSS Location | chr17:37,139,506-37,140,256 | Size | 243 |
| Sequence | GTTACCTGCGGACGGAGCAGAACGGAAGCAGAGGGACAAAGTAGCGGATTCCTGACTTCTGGCAA GGGCCCCTTCCTGGGTTTCACGCCGCTGCGTTCTGGTCGAGGCTGGAACGCGCGCCCAGCCCTTT GTGTGGCTGTGGTCCGAGGCTACGGCTCAGAAGCCGAGCGCTGGGAACGGCAGGACTGCCGAGCC TCAAGTAGGGCTGTCGAGCGCGGGCTCCTGCACCAGGAAAGAACAATC |
||||
| Links |
UCSC Browser(chr17:37,139,506-37,140,256) IGTC() |
||||
Homology Search Results
| [AK136241] Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length enriched library, clone:7420489J10 product:zinc finger protein 57, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and ES cell line; Mol/MSM-1. This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Zfp57) |
||||