Gene Name | chromobox 3 | Gene Symbol | Cbx3 | |||
Chromosome | 6 | Genomic Location | chr6:51,420,201-51,434,427 | ![]() |
||
Synonyms | heterochromatin protein 1 gamma, HP1g, M32 | |||||
Links |
UCSC Genome Browser(chr6:51,420,201-51,434,427) NCBI Gene(12417) IGTC(Cbx3,2) UNIGene(Mm.280968) |
MGI(108515) KEGG GENES(mmu:12417) EST Profile(mm.280968) |
Other Clone Trapped This Gene |
---|
21-MT118, K10H04 |
Trap Vector | pU-21T | Cell Line | Mol/MSM-1 | Method | 5'-RACE |
Accession | AB695308 | GSS Location | chr6:51,420,641-51,420,737 | Size | 97 |
Sequence | GGAGCTGCCCGCGCCCCCTCCCCTCGGATGTGGCTGAACCGAAGCGCGCAGGCGGGAGACTCTGC AGGATCCGCGGCCCTGAGCATCGGAGCGGTAA |
||||
Links |
UCSC Browser(chr6:51,420,641-51,420,737) IGTC() |
[NM_007624] Mus musculus chromobox 3 (Cbx3), mRNA. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and ES cell line; Mol/MSM-1. This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Cbx3) |