ID 21-MT94
Registered: 2013.02.24 Last update: 2018.05.31
| Gene Name | glycosyltransferase 1 domain containing 1 | Gene Symbol | Glt1d1 | |||
| Chromosome | 5 | Genomic Location | chr5:128,112,075-128,190,087 |  |
||
| Synonyms | 5730455A04Rik | |||||
| Links |
UCSC Genome Browser(chr5:128,112,075-128,190,087) NCBI Gene(319804) IGTC(Glt1d1,) UNIGene(Mm.237888) |
MGI(2442755) KEGG GENES(mmu:319804) EST Profile(mm.237888) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | Mol/MSM-1 | Method | 5'-RACE |
| Accession | AB695251 | GSS Location | chr5:128,112,603-128,112,721 | Size | 119 |
| Sequence | CCTACCCCTCNGCCCGGGCCTGGTGGCCCAGTTCTTGGCGGTAGCGACGACATGCGGCTCCTGTT CCTGGCAGTACTGAGGCCTCACACTGGCAACGCGGTCACAGCTGGGCGCCTACG |
||||
| Links |
UCSC Browser(chr5:128,112,603-128,112,721) IGTC() |
||||
Homology Search Results
| [NM_177005] Mus musculus glycosyltransferase 1 domain containing 1 (Glt1d1), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and ES cell line; Mol/MSM-1. This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Glt1d1) |
||||