ID 21-T102
Registered: 2006.12.06 Last update: 2006.12.08
| Gene Name | cleft lip and palate associated transmembrane protein 1 | Gene Symbol | Clptm1 | |||
| Chromosome | 7 | Genomic Location | chr7:20,216,000-20,252,000 |  |
||
| Synonyms | HS9, N14 | |||||
| Links |
UCSC Genome Browser(chr7:20,216,000-20,252,000) NCBI Gene(56457) IGTC(Clptm1,4264) UNIGene(Mm.290960) |
MGI(1927155) KEGG GENES(mmu:56457) EST Profile(mm.290960) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB286657 | GSS Location | chr7:20,250,283-20,250,369 | Size | 87 |
| Sequence | ACCCGGAGCAGGAAGATGGCGGCGGCGCAGGAGGCGGACGGGGCCGGCAGCGCCGTGGTGGCGGC CGGGGGAGGCAGCTCTGGTCAG |
||||
| Links |
UCSC Browser(chr7:20,250,283-20,250,369) IGTC(Ayu21-T102) |
||||
Homology Search Results
| [AK165742] Mus musculus 13 days embryo spinal cord cDNA, RIKEN full-length enriched library, clone: G630040L22 product:cleft lip and palate associated transmembrane protein 1, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Clptm1) |
||||