Gene Name | abhydrolase domain containing 12 | Gene Symbol | Abhd12 | |||
Chromosome | 2 | Genomic Location | chr2:150,658,000-150,733,000 | |||
Synonyms | 1500011G07Rik, 6330583M11Rik, AI431047, AW547313 | |||||
Links |
UCSC Genome Browser(chr2:150,658,000-150,733,000) NCBI Gene(76192) IGTC(Abhd12,9635) UNIGene(Mm.112632) |
MGI(1923442) KEGG GENES(mmu:76192) EST Profile(mm.112632) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB289442 | GSS Location | chr2:150,730,093-150,730,263 | Size | 171 |
Sequence | CGTCACCTTGGAGCATGAGCGCTGCGCCGCCTCAGGCTCGTCCTCCTCCGGCTCGGCCGCCGCGG CGCTGGACGCCGACTGCAGCTTGAAGCAGAACCTGCGTCTGGCGGGCAAGGGGACGGCAGAGCCG CACAGCGCATCCGACGCGGGCATGAAGCGGGCGCTGGGCAG |
||||
Links |
UCSC Browser(chr2:150,730,093-150,730,263) IGTC(Ayu21-T108) |
[BC002138] Mus musculus abhydrolase domain containing 12, mRNA (cDNA clone IMAGE:3484538), partial cds. |
Card ID | 1075 | ||||
Strain Name | B6;CB-Abhd12Gt(pU-21T)108Imeg | ||||
Internal Code | Ayu21-T108 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Abhd12) |