Gene Name | pluripotency associated transcript 3 | Gene Symbol | Platr3 | |||
Chromosome | 2 | Genomic Location | chr2:135,466,385-135,483,166 | ![]() |
||
Synonyms | Gm14074 | |||||
Links |
UCSC Genome Browser(chr2:135,466,385-135,483,166) NCBI Gene(102642414) IGTC(Platr3,) UNIGene(Mm.156895) |
MGI(3651129) KEGG GENES(mmu:) EST Profile(mm.156895) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB278135 | GSS Location | chr2:135,472,259-135,477,293 | Size | 132 |
Sequence | CCCCTTTTGGAATGGGACAGCAGAGGGGGCTGTGTTTCATCTCAGCGATCAACTGGTTGACCTAT ATGTGAGGGCAAGATTTTACACTCCTTTGAGGTGAGACAGACCAACAGATACCTGTAAACCAATG AG |
||||
Links |
UCSC Browser(chr2:135,472,259-135,477,293) IGTC(Ayu21-T114) |
[BG091049] mac20a09.y1 Soares mouse 3NbMS Mus musculus cDNA clone IMAGE:4000049 5', mRNA sequence. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Platr3) |