ID 21-T115
Registered: 2006.12.06 Last update: 2018.05.31
| Gene Name | RAN binding protein 3 | Gene Symbol | Ranbp3 | |||
| Chromosome | 17 | Genomic Location | chr17:56,810,000-56,852,000 |  |
||
| Synonyms | 2610024N24Rik, AA408221 | |||||
| Links |
UCSC Genome Browser(chr17:56,810,000-56,852,000) NCBI Gene(71810) IGTC(Ranbp3,262) UNIGene(Mm.29608) |
MGI(1919060) KEGG GENES(mmu:71810) EST Profile(mm.29608) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB286660 | GSS Location | chr17:56,812,783-56,825,484 | Size | 108 |
| Sequence | GGGCCTTGTGGGAGGGCTTAAGGAAGTAAAATGGCGGACCTGGCGAACGAAGAAAAGCCTGCCGT CGCACCGTCTGTCTTTGTGTTTCAAAAGGACAAAGGACAGAAG |
||||
| Links |
UCSC Browser(chr17:56,812,783-56,825,484) IGTC(Ayu21-T115) |
||||
Homology Search Results
| [AK155301] Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630217F23 product:similar to Ranbp3-a protein (Fragment) [Homo sapiens], full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Ranbp3) |
||||