ID 21-T146
Registered: 2007.02.01 Last update: 2018.05.31
| Gene Name | predicted gene 45871 | Gene Symbol | Gm45871 | |||
| Chromosome | 18 | Genomic Location | chr18:90,748,878-90,763,364 |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr18:90,748,878-90,763,364) NCBI Gene(108168395) IGTC(Gm45871,) UNIGene(Mm.) |
MGI(5804986) KEGG GENES(mmu:108168395) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB370087 | GSS Location | chr18:90,749,237-90,749,287 | Size | 90 |
| Sequence | GGTCTGGCGGCTGATGCTGTGAAGCGCGCTCAGGCAAGCTCCGAAGTTGTGACCGATATTTCACG TCCTACAGTGTGTGTTTCTTATTTT |
||||
| Links |
UCSC Browser(chr18:90,749,237-90,749,287) IGTC(Ayu21-T146) |
||||
Homology Search Results
| [BC062254] Mus musculus cDNA clone IMAGE:3824676, partial cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Gm45871) |
||||