Gene Name | RIKEN cDNA 3110009E18 gene | Gene Symbol | 3110009E18Rik | |||
Chromosome | 1 | Genomic Location | chr1:122,017,000-122,100,000 | ![]() |
||
Synonyms | ||||||
Links |
UCSC Genome Browser(chr1:122,017,000-122,100,000) NCBI Gene(73103) IGTC(3110009E18Rik,20845) UNIGene(Mm.271602) |
MGI(1920353) KEGG GENES(mmu:73103) EST Profile(mm.271602) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB290807 | GSS Location | chr1:122,017,751-122,017,794 | Size | 44 |
Sequence | ATTGCGCACGCGCGGGGAGGAGCCGCGGGGCACGTTGGGAGCAG | ||||
Links |
UCSC Browser(chr1:122,017,751-122,017,794) IGTC(Ayu21-T153) |
[BC028767] Mus musculus RIKEN cDNA 3110009E18 gene, mRNA (cDNA clone MGC:41348 IMAGE:1264217), complete cds. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for 3110009E18Rik) |