ID 21-T153
Registered: 2007.01.18 Last update: 2008.02.22
| Gene Name | RIKEN cDNA 3110009E18 gene | Gene Symbol | 3110009E18Rik | |||
| Chromosome | 1 | Genomic Location | chr1:122,017,000-122,100,000 |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr1:122,017,000-122,100,000) NCBI Gene(73103) IGTC(3110009E18Rik,20845) UNIGene(Mm.271602) |
MGI(1920353) KEGG GENES(mmu:73103) EST Profile(mm.271602) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB290807 | GSS Location | chr1:122,017,751-122,017,794 | Size | 44 |
| Sequence | ATTGCGCACGCGCGGGGAGGAGCCGCGGGGCACGTTGGGAGCAG | ||||
| Links |
UCSC Browser(chr1:122,017,751-122,017,794) IGTC(Ayu21-T153) |
||||
Homology Search Results
| [BC028767] Mus musculus RIKEN cDNA 3110009E18 gene, mRNA (cDNA clone MGC:41348 IMAGE:1264217), complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for 3110009E18Rik) |
||||