ID 21-T154
Registered: 2007.01.18 Last update: 2018.05.31
| Gene Name | KN motif and ankyrin repeat domains 3 | Gene Symbol | Kank3 | |||
| Chromosome | 17 | Genomic Location | chr17:33,947,000-33,961,000 |  |
||
| Synonyms | Ankrd47, D17Ertd288e, 0610013D04Rik | |||||
| Links |
UCSC Genome Browser(chr17:33,947,000-33,961,000) NCBI Gene(80880) IGTC(Kank3,13553) UNIGene(Mm.196330) |
MGI(1098615) KEGG GENES(mmu:80880) EST Profile(mm.196330) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB290808 | GSS Location | chr17:33,947,468-33,953,190 | Size | 104 |
| Sequence | GGGGCTCGGGTGCGGTGCGGGCGCTGCCGGGGCTTCTCATTCAGGCTGTCTGGTGGCTGCTCCAG GAAACATGGCCAAGTTTGTCCTGAATCAGAACCTTCCTG |
||||
| Links |
UCSC Browser(chr17:33,947,468-33,953,190) IGTC(Ayu21-T154) |
||||
Homology Search Results
| [AK002623] Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:0610013D04 product:hypothetical Yeast DNA-binding domain containing protein, full insert sequence. |
Mouse Information
| Card ID | 1041 | ||||
| Strain Name | B6;CB-Kank3Gt(pU-21T)154Imeg | ||||
| Internal Code | Ayu21-T154 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Kank3) |
||||