ID 21-T160

Registered: 2007.02.01   Last update: 2018.06.01
Gene Name signal peptide peptidase like 2B Gene Symbol Sppl2b
Chromosome 10 Genomic Location chr10:80,317,500-80,332,000
Synonyms PSL1, AW550292, 3110056O03Rik
Links UCSC Genome Browser(chr10:80,317,500-80,332,000)
NCBI Gene(73218)
IGTC(Sppl2b,23401)
UNIGene(Mm.3285)
 MGI(1920468)
KEGG GENES(mmu:73218)
EST Profile(mm.3285)
Other Clone Trapped This Gene
Trap Vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB303362 GSS Location chr10:80,318,010-80,318,133 Size 128
Sequence TCTAGGCGGAAGCACGTTGCGGCGTCCCGAAGGCGTTGCCAGGAAACCTTCCGCCTAGAGCTGCG
GGGGGACCGGCGGACATGGCCGCGGCGCGGCTGGCCGCAGCTTTGCTGCTACTCGCGGCCCAG
Links UCSC Browser(chr10:80,318,010-80,318,133)
IGTC(Ayu21-T160)

Homology Search Results

[AK046804] Mus musculus 10 days neonate medulla oblongata cDNA, RIKEN full-length enriched library, clone:B830011P16 product:hypothetical Protease associated (PA) domain containing protein, full insert sequence.

Mouse Information

Card ID 1043
Strain Name B6;CB-3110056O03RikGt(pU-21T)160Imeg
Internal Code Ayu21-T160
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "The intramembrane proteases signal Peptide peptidase-like 2a and 2b have distinct functions in vivo." Schneppenheim, J., Huttl, S., Mentrup, T., Lullmann-Rauch, R., Rothaug, M., Engelke, M., Dittmann, K., Dressel, R., Araki, M., Araki, K., Wienands, J., Fluhrer, R., Saftig, P., Schroder, B., Mol. Cell. Biology, 34 (8), 1398-1411 (2014). PubMed ID:24492962.
Links IMSR (for Sppl2b)

Expression Information

DescriptionX-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female